software alpha ease version 5.5 Search Results


93
Thermo Fisher gut integrity muc2 forward xm 421035 55 gctacaggatctgcctttgc muc2
Gut Integrity Muc2 Forward Xm 421035 55 Gctacaggatctgcctttgc Muc2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gut integrity muc2 forward xm 421035 55 gctacaggatctgcctttgc muc2/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gut integrity muc2 forward xm 421035 55 gctacaggatctgcctttgc muc2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

96
Carna Inc ck2α2 β

Ck2α2 β, supplied by Carna Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ck2α2 β/product/Carna Inc
Average 96 stars, based on 1 article reviews
ck2α2 β - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Amersham Life Sciences Inc 1-14c]glucose

1 14c]Glucose, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1-14c]glucose/product/Amersham Life Sciences Inc
Average 90 stars, based on 1 article reviews
1-14c]glucose - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Edwards Lifesciences Inc ecmo venous cannula

Ecmo Venous Cannula, supplied by Edwards Lifesciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ecmo venous cannula/product/Edwards Lifesciences Inc
Average 90 stars, based on 1 article reviews
ecmo venous cannula - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Alpha Diagnostics myelin oligoglycoprotein (mog35–55) peptide

Myelin Oligoglycoprotein (Mog35–55) Peptide, supplied by Alpha Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/myelin oligoglycoprotein (mog35–55) peptide/product/Alpha Diagnostics
Average 90 stars, based on 1 article reviews
myelin oligoglycoprotein (mog35–55) peptide - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Novozymes limited commercial amyloglucosidase spirizyme fuel hs

Commercial Amyloglucosidase Spirizyme Fuel Hs, supplied by Novozymes limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/commercial amyloglucosidase spirizyme fuel hs/product/Novozymes limited
Average 90 stars, based on 1 article reviews
commercial amyloglucosidase spirizyme fuel hs - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Orange Scientific cellulose membrane q1210-55 f3

Cellulose Membrane Q1210 55 F3, supplied by Orange Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cellulose membrane q1210-55 f3/product/Orange Scientific
Average 90 stars, based on 1 article reviews
cellulose membrane q1210-55 f3 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

86
Thermo Fisher glucose vitc insulin transferrin selenium its

Glucose Vitc Insulin Transferrin Selenium Its, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glucose vitc insulin transferrin selenium its/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
glucose vitc insulin transferrin selenium its - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp gabpb1 hs00242573 m1

Gene Exp Gabpb1 Hs00242573 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp gabpb1 hs00242573 m1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp gabpb1 hs00242573 m1 - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier

96
Carna Inc cdk2 cyca2 protein

Cdk2 Cyca2 Protein, supplied by Carna Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cdk2 cyca2 protein/product/Carna Inc
Average 96 stars, based on 1 article reviews
cdk2 cyca2 protein - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

93
Proteintech pparg
Fig. 5 Kaempferol modulated estrogen metabolism pathways and differentially regulates <t>PPARG</t> expression in EC cells of different ER subtypes. A– <t>B</t> <t>HSD17B1</t> and HSD17B1-associated genes, such as ESRRA, PPARG, and ESR1, are involved in several estrogen metabolism pathways, such as steroid binding, 17- beta-hydroxysteroid dehydrogenase (NADP+) activity, steroid hormone biosynthesis, and regulation of hormone levels. C Kaempferol suppressed the expression of PPARG in ER-positive AN3 CA and promoted the expression of PPARG in ER-negative HEC-1-A. D–I Kaempferol suppressed the expression of PPARGC1A and ESRRA in both AN3 CA (D–F) and HEC-1-A cells (G–I), without modulating ESR1. Western blotting (D–E and G–H) and the IHC scores (F and I) confirmed the differential expression of PPARGC1A and ESRRA. Results are presented as means and SDs. Compared with the negative control, *, #P < 0.05, **, ##P < 0.01, ***, ###P < 0.001
Pparg, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pparg/product/Proteintech
Average 93 stars, based on 1 article reviews
pparg - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Proteintech tubulin
Fig. 1. Purification and identification <t>of</t> <t>α-tubulin</t> detyrosinase. (A) Schematic representation of the known α-tubulin C-terminal cleavages, which generate detyr- osinated (αΔ1), αΔ2-, and αΔ3-tubulins. (B) Immunoblots of an in vitro assay testing the effect of inhibitors specific to different types of proteases on the endogenous detyrosinase activity from HEK-2KO cells. PMSF, phenylmethylsulfonyl fluoride; IAA, iodoacetamide; NEM, N-ethylmaleimide. (C) Immunoblot of an in vitro assay testing the effect of different metal ions on the endogenous detyrosinase activity from HEK-2KO cells. (D) Immunoblots of detyrosinase activity in different fractions following gel filtration assayed on endogenous tubulin. Fraction numbers and molecular mass standards used to calibrate the column are indicated on the top. (E) Immunoblots of detyrosinase activity in different fractions after cation-exchange chromatography (Mono S) of the enriched detyrosinase activity after the first step of purification. The activity was measured against recombinant GST–α-tubulin, which was added to each fraction. Fractions 11 (blue) and 15 (red) were subjected to mass spectrometry analysis as a negative and positive fraction, respectively. (F) AlphaFold-based prediction of the putative active site of KIAA0895L.
Tubulin, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tubulin/product/Proteintech
Average 93 stars, based on 1 article reviews
tubulin - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Journal: Cell Reports Methods

Article Title: Motif-centric phosphoproteomics to target kinase-mediated signaling pathways

doi: 10.1016/j.crmeth.2021.100138

Figure Lengend Snippet:

Article Snippet: CK2α2/β (CSNK2A2/B) , Carna Biosciences , Catalog:05-185.

Techniques: Recombinant, Bicinchoninic Acid Protein Assay, Sequencing, Modification, Software

Fig. 5 Kaempferol modulated estrogen metabolism pathways and differentially regulates PPARG expression in EC cells of different ER subtypes. A– B HSD17B1 and HSD17B1-associated genes, such as ESRRA, PPARG, and ESR1, are involved in several estrogen metabolism pathways, such as steroid binding, 17- beta-hydroxysteroid dehydrogenase (NADP+) activity, steroid hormone biosynthesis, and regulation of hormone levels. C Kaempferol suppressed the expression of PPARG in ER-positive AN3 CA and promoted the expression of PPARG in ER-negative HEC-1-A. D–I Kaempferol suppressed the expression of PPARGC1A and ESRRA in both AN3 CA (D–F) and HEC-1-A cells (G–I), without modulating ESR1. Western blotting (D–E and G–H) and the IHC scores (F and I) confirmed the differential expression of PPARGC1A and ESRRA. Results are presented as means and SDs. Compared with the negative control, *, #P < 0.05, **, ##P < 0.01, ***, ###P < 0.001

Journal: Journal of translational medicine

Article Title: An integrated approach of network pharmacology, molecular docking, and experimental verification uncovers kaempferol as the effective modulator of HSD17B1 for treatment of endometrial cancer.

doi: 10.1186/s12967-023-04048-z

Figure Lengend Snippet: Fig. 5 Kaempferol modulated estrogen metabolism pathways and differentially regulates PPARG expression in EC cells of different ER subtypes. A– B HSD17B1 and HSD17B1-associated genes, such as ESRRA, PPARG, and ESR1, are involved in several estrogen metabolism pathways, such as steroid binding, 17- beta-hydroxysteroid dehydrogenase (NADP+) activity, steroid hormone biosynthesis, and regulation of hormone levels. C Kaempferol suppressed the expression of PPARG in ER-positive AN3 CA and promoted the expression of PPARG in ER-negative HEC-1-A. D–I Kaempferol suppressed the expression of PPARGC1A and ESRRA in both AN3 CA (D–F) and HEC-1-A cells (G–I), without modulating ESR1. Western blotting (D–E and G–H) and the IHC scores (F and I) confirmed the differential expression of PPARGC1A and ESRRA. Results are presented as means and SDs. Compared with the negative control, *, #P < 0.05, **, ##P < 0.01, ***, ###P < 0.001

Article Snippet: The whole cell lysates and tumor homogenates (50 μg) were resolved on an 8 ~ 12% SDS–polyacrylamide gel, transferred to a polyvinylidene difluoride membrane (NEN Life Sciences, Boston, MA), probed sequentially with antibodies against ESR1 (ab108398, 67 kDa), ESRRA (ab137489, 55 kDa), PPARGC1A (ab188102, 91 kDa) (Abcam, Cambridge, MA, U. S.), CASP3/p17/p19 (19677–1, 35 kDa), CASP9/p35/p10 (66169–1, 46 kDa), PPARG (16643–1, 55 kDa), HSD17B1 (25334–1, 35 kDa) (Proteintech, Wuhan, China) at 4 °C overnight, rinsed, and incubated with the goat anti-rabbit secondary antibody (Abcam, Cambridge, MA).

Techniques: Expressing, Binding Assay, Activity Assay, Western Blot, Quantitative Proteomics, Negative Control

Fig. 1. Purification and identification of α-tubulin detyrosinase. (A) Schematic representation of the known α-tubulin C-terminal cleavages, which generate detyr- osinated (αΔ1), αΔ2-, and αΔ3-tubulins. (B) Immunoblots of an in vitro assay testing the effect of inhibitors specific to different types of proteases on the endogenous detyrosinase activity from HEK-2KO cells. PMSF, phenylmethylsulfonyl fluoride; IAA, iodoacetamide; NEM, N-ethylmaleimide. (C) Immunoblot of an in vitro assay testing the effect of different metal ions on the endogenous detyrosinase activity from HEK-2KO cells. (D) Immunoblots of detyrosinase activity in different fractions following gel filtration assayed on endogenous tubulin. Fraction numbers and molecular mass standards used to calibrate the column are indicated on the top. (E) Immunoblots of detyrosinase activity in different fractions after cation-exchange chromatography (Mono S) of the enriched detyrosinase activity after the first step of purification. The activity was measured against recombinant GST–α-tubulin, which was added to each fraction. Fractions 11 (blue) and 15 (red) were subjected to mass spectrometry analysis as a negative and positive fraction, respectively. (F) AlphaFold-based prediction of the putative active site of KIAA0895L.

Journal: Science advances

Article Title: A family of carboxypeptidases catalyzing α- and β-tubulin tail processing and deglutamylation.

doi: 10.1126/sciadv.adi7838

Figure Lengend Snippet: Fig. 1. Purification and identification of α-tubulin detyrosinase. (A) Schematic representation of the known α-tubulin C-terminal cleavages, which generate detyr- osinated (αΔ1), αΔ2-, and αΔ3-tubulins. (B) Immunoblots of an in vitro assay testing the effect of inhibitors specific to different types of proteases on the endogenous detyrosinase activity from HEK-2KO cells. PMSF, phenylmethylsulfonyl fluoride; IAA, iodoacetamide; NEM, N-ethylmaleimide. (C) Immunoblot of an in vitro assay testing the effect of different metal ions on the endogenous detyrosinase activity from HEK-2KO cells. (D) Immunoblots of detyrosinase activity in different fractions following gel filtration assayed on endogenous tubulin. Fraction numbers and molecular mass standards used to calibrate the column are indicated on the top. (E) Immunoblots of detyrosinase activity in different fractions after cation-exchange chromatography (Mono S) of the enriched detyrosinase activity after the first step of purification. The activity was measured against recombinant GST–α-tubulin, which was added to each fraction. Fractions 11 (blue) and 15 (red) were subjected to mass spectrometry analysis as a negative and positive fraction, respectively. (F) AlphaFold-based prediction of the putative active site of KIAA0895L.

Article Snippet: Membranes were incubated with rabbit polyE (anti-polyglutamylation; 1:1000), mouse anti-GFP (1:5000; Torrey Pines Biolabs), rabbit anti-GST (1:2000), rabbit anti–detyrosinated α-tubulin [1:1000; (39)], rabbit anti–Δ2-tubulin (1:1000; gift of L. Lafanechère), mouse 6-11B-1 (anti–acetylated tubulin, 1:2000; Sigma-Aldrich), mouse 12G10 (anti–α-tubulin; 1:1000, DSHB), rat anti–tyrosinated tubulin [YL1/2; 1:1000; (55)], rabbit anti–βI-Δ3 (1:1000; this study), mouse anti-βI-tubulin (1:1000; Sigma-Aldrich, SAB4200732), rabbit anti–Sf9-Δ1-α-tubulin [1:1000; (23)], mouse GT335 [1:1000; (17)] rabbit anti–hemagglutinin (HA) (1:1000; Santa Cruz Biotechnology) or mouse anti-His (1:1000; ProteinTech) antibodies.

Techniques: Purification, Western Blot, In Vitro, Activity Assay, Filtration, Chromatography, Recombinant, Mass Spectrometry

Fig. 3. Enzymatic mechanism and substrate specificity of TMCP1. (A) Coomassie staining of purified proteins used for in vitro studies of TMCP1. His-TMCP1, His- TMCP1-E281A, GST–α-tubulin, and GST–αΔ1-tubulin were expressed in BL21 bacteria, whereas tubulin and MT were purified and assembled from insect (Sf9) cells. Mw, molecular weight. (B) Immunoblots of an in vitro assay using recombinant His-TMCP1 or its catalytically inactive version (E281A) and bacterially produced GST–α-tubulin. (C) Immunoblots of an in vitro assay involving bacterially produced GST–α-tubulin or GST–αΔ1-tubulin treated with recombinant His-TMCP1. (D) Immunoblots of an in vitro time-course assay using recombinant His-TMCP1 and either the WT GST–α-tubulin or its mutated versions in which the C-terminal tyrosine has been replaced by alanine, glutamate, or glycine. WB, Western blot. (E) Immunoblots of an in vitro assay measuring time-dependent activity of recombinant His-TMCP1 toward Sf9-derived tubulin dimers or MTs. (F) Graphical representation of His-TMCP1 activity toward Sf9-derived tubulin or MTs. Immunoblot signals were quantified for each time point (mean ± SD; n = 3 independent experiments). A.U., arbitrary units.

Journal: Science advances

Article Title: A family of carboxypeptidases catalyzing α- and β-tubulin tail processing and deglutamylation.

doi: 10.1126/sciadv.adi7838

Figure Lengend Snippet: Fig. 3. Enzymatic mechanism and substrate specificity of TMCP1. (A) Coomassie staining of purified proteins used for in vitro studies of TMCP1. His-TMCP1, His- TMCP1-E281A, GST–α-tubulin, and GST–αΔ1-tubulin were expressed in BL21 bacteria, whereas tubulin and MT were purified and assembled from insect (Sf9) cells. Mw, molecular weight. (B) Immunoblots of an in vitro assay using recombinant His-TMCP1 or its catalytically inactive version (E281A) and bacterially produced GST–α-tubulin. (C) Immunoblots of an in vitro assay involving bacterially produced GST–α-tubulin or GST–αΔ1-tubulin treated with recombinant His-TMCP1. (D) Immunoblots of an in vitro time-course assay using recombinant His-TMCP1 and either the WT GST–α-tubulin or its mutated versions in which the C-terminal tyrosine has been replaced by alanine, glutamate, or glycine. WB, Western blot. (E) Immunoblots of an in vitro assay measuring time-dependent activity of recombinant His-TMCP1 toward Sf9-derived tubulin dimers or MTs. (F) Graphical representation of His-TMCP1 activity toward Sf9-derived tubulin or MTs. Immunoblot signals were quantified for each time point (mean ± SD; n = 3 independent experiments). A.U., arbitrary units.

Article Snippet: Membranes were incubated with rabbit polyE (anti-polyglutamylation; 1:1000), mouse anti-GFP (1:5000; Torrey Pines Biolabs), rabbit anti-GST (1:2000), rabbit anti–detyrosinated α-tubulin [1:1000; (39)], rabbit anti–Δ2-tubulin (1:1000; gift of L. Lafanechère), mouse 6-11B-1 (anti–acetylated tubulin, 1:2000; Sigma-Aldrich), mouse 12G10 (anti–α-tubulin; 1:1000, DSHB), rat anti–tyrosinated tubulin [YL1/2; 1:1000; (55)], rabbit anti–βI-Δ3 (1:1000; this study), mouse anti-βI-tubulin (1:1000; Sigma-Aldrich, SAB4200732), rabbit anti–Sf9-Δ1-α-tubulin [1:1000; (23)], mouse GT335 [1:1000; (17)] rabbit anti–hemagglutinin (HA) (1:1000; Santa Cruz Biotechnology) or mouse anti-His (1:1000; ProteinTech) antibodies.

Techniques: Staining, Purification, In Vitro, Bacteria, Molecular Weight, Western Blot, Recombinant, Produced, Activity Assay, Derivative Assay

Fig. 4. Characterization of TMCP2, a paralog of TMCP1. (A) Schematic alignment of TMCP1 and TMCP2 (isoform 3) shows a high degree of conservation in the C- terminal region that contains the active site. The region encoded by the alternative exon is indicated in red. Sequence alignment of the active site region with highlighted essential glutamates is presented below. (B) Immunoblots of protein extracts from HEK-2KO cells expressing TMCP1 and several isoforms of TMCP2. (C) Immunoblots of protein extracts from HEK-2KO cells expressing TMCP2-3 or its enzymatically inactive versions (E329A and E364A). (D) Immunofluorescence analysis of RPE1 cells express- ing TMCP2-3 or its enzymatically inactive version (E329A) and TMCP2-5. Scale bars, 20 μm. (E) Immunoblots of an in vitro assay involving recombinant His-TMCP2-5 and bacterially produced GST–α-tubulin or GST–αΔ1-tubulin. (F) Schematic representation of the potential epitopes (highlighted in red) recognized by αΔ2 antibody present in the C terminus of α-, βI-, βII-, and βIV-tubulin. (G) Immunoblots of an in vitro time-course assay using recombinant His-TMCP2-5 in the presence of either the WT GST–α- tubulin or its mutated versions in which the C-terminal tyrosine has been replaced by alanine, glutamate, or glycine.

Journal: Science advances

Article Title: A family of carboxypeptidases catalyzing α- and β-tubulin tail processing and deglutamylation.

doi: 10.1126/sciadv.adi7838

Figure Lengend Snippet: Fig. 4. Characterization of TMCP2, a paralog of TMCP1. (A) Schematic alignment of TMCP1 and TMCP2 (isoform 3) shows a high degree of conservation in the C- terminal region that contains the active site. The region encoded by the alternative exon is indicated in red. Sequence alignment of the active site region with highlighted essential glutamates is presented below. (B) Immunoblots of protein extracts from HEK-2KO cells expressing TMCP1 and several isoforms of TMCP2. (C) Immunoblots of protein extracts from HEK-2KO cells expressing TMCP2-3 or its enzymatically inactive versions (E329A and E364A). (D) Immunofluorescence analysis of RPE1 cells express- ing TMCP2-3 or its enzymatically inactive version (E329A) and TMCP2-5. Scale bars, 20 μm. (E) Immunoblots of an in vitro assay involving recombinant His-TMCP2-5 and bacterially produced GST–α-tubulin or GST–αΔ1-tubulin. (F) Schematic representation of the potential epitopes (highlighted in red) recognized by αΔ2 antibody present in the C terminus of α-, βI-, βII-, and βIV-tubulin. (G) Immunoblots of an in vitro time-course assay using recombinant His-TMCP2-5 in the presence of either the WT GST–α- tubulin or its mutated versions in which the C-terminal tyrosine has been replaced by alanine, glutamate, or glycine.

Article Snippet: Membranes were incubated with rabbit polyE (anti-polyglutamylation; 1:1000), mouse anti-GFP (1:5000; Torrey Pines Biolabs), rabbit anti-GST (1:2000), rabbit anti–detyrosinated α-tubulin [1:1000; (39)], rabbit anti–Δ2-tubulin (1:1000; gift of L. Lafanechère), mouse 6-11B-1 (anti–acetylated tubulin, 1:2000; Sigma-Aldrich), mouse 12G10 (anti–α-tubulin; 1:1000, DSHB), rat anti–tyrosinated tubulin [YL1/2; 1:1000; (55)], rabbit anti–βI-Δ3 (1:1000; this study), mouse anti-βI-tubulin (1:1000; Sigma-Aldrich, SAB4200732), rabbit anti–Sf9-Δ1-α-tubulin [1:1000; (23)], mouse GT335 [1:1000; (17)] rabbit anti–hemagglutinin (HA) (1:1000; Santa Cruz Biotechnology) or mouse anti-His (1:1000; ProteinTech) antibodies.

Techniques: Sequencing, Western Blot, Expressing, Immunofluorescence, In Vitro, Recombinant, Produced

Fig. 5. TMCP2 catalyzes previously unknown βIΔ3 modification. (A) Immunoblots of protein extracts from HEK-2KO cells expressing TMCP1 and several isoforms of TMCP2 probed with the indicated antibodies, including the newly generated anti–βIΔ3-tubulin antibody. (B) Immunofluorescence analysis of RPE1 cells expressing TMCP2-3 or its enzymatically inactive version (E329A) and TMCP2-5 using anti–βI-tubulin or anti–βIΔ3 antibody. Scale bars, 20 μm. (C) Immunoblots of an in vitro assay involving recombinant TMCP2-5 or its enzymatically inactive version and bacterially produced GST-α-, βI-, βII-, and βIV-tubulin. (D) Immunoblot analysis of an in vitro assay involving recombinant TMCP2-5 and tubulin dimers enriched for βI- or βIV-tubulin after Strep-tag–based purification from HEK293 cells. (E) Immunoblots of protein extracts from SH-SY5Y cells following knockdown of TMCP2 using three different siRNAs. (F) Immunofluorescence analysis of endogenous βIΔ3-tubulin in nondividing, mitotic, or differentiated RPE1 cells. βIΔ3-tubulin is enriched at centrioles and mitotic spindles as well as primary cilia. Scale bars, 5 μm; inset, 1 μm. (G) Immunofluorescence analysis of either dividing or differentiated RPE1 cells knockdown for TMCP2. Scale bars, 5 μm for dividing RPE1 and 2 μm for differentiated RPE1.

Journal: Science advances

Article Title: A family of carboxypeptidases catalyzing α- and β-tubulin tail processing and deglutamylation.

doi: 10.1126/sciadv.adi7838

Figure Lengend Snippet: Fig. 5. TMCP2 catalyzes previously unknown βIΔ3 modification. (A) Immunoblots of protein extracts from HEK-2KO cells expressing TMCP1 and several isoforms of TMCP2 probed with the indicated antibodies, including the newly generated anti–βIΔ3-tubulin antibody. (B) Immunofluorescence analysis of RPE1 cells expressing TMCP2-3 or its enzymatically inactive version (E329A) and TMCP2-5 using anti–βI-tubulin or anti–βIΔ3 antibody. Scale bars, 20 μm. (C) Immunoblots of an in vitro assay involving recombinant TMCP2-5 or its enzymatically inactive version and bacterially produced GST-α-, βI-, βII-, and βIV-tubulin. (D) Immunoblot analysis of an in vitro assay involving recombinant TMCP2-5 and tubulin dimers enriched for βI- or βIV-tubulin after Strep-tag–based purification from HEK293 cells. (E) Immunoblots of protein extracts from SH-SY5Y cells following knockdown of TMCP2 using three different siRNAs. (F) Immunofluorescence analysis of endogenous βIΔ3-tubulin in nondividing, mitotic, or differentiated RPE1 cells. βIΔ3-tubulin is enriched at centrioles and mitotic spindles as well as primary cilia. Scale bars, 5 μm; inset, 1 μm. (G) Immunofluorescence analysis of either dividing or differentiated RPE1 cells knockdown for TMCP2. Scale bars, 5 μm for dividing RPE1 and 2 μm for differentiated RPE1.

Article Snippet: Membranes were incubated with rabbit polyE (anti-polyglutamylation; 1:1000), mouse anti-GFP (1:5000; Torrey Pines Biolabs), rabbit anti-GST (1:2000), rabbit anti–detyrosinated α-tubulin [1:1000; (39)], rabbit anti–Δ2-tubulin (1:1000; gift of L. Lafanechère), mouse 6-11B-1 (anti–acetylated tubulin, 1:2000; Sigma-Aldrich), mouse 12G10 (anti–α-tubulin; 1:1000, DSHB), rat anti–tyrosinated tubulin [YL1/2; 1:1000; (55)], rabbit anti–βI-Δ3 (1:1000; this study), mouse anti-βI-tubulin (1:1000; Sigma-Aldrich, SAB4200732), rabbit anti–Sf9-Δ1-α-tubulin [1:1000; (23)], mouse GT335 [1:1000; (17)] rabbit anti–hemagglutinin (HA) (1:1000; Santa Cruz Biotechnology) or mouse anti-His (1:1000; ProteinTech) antibodies.

Techniques: Modification, Western Blot, Expressing, Generated, Immunofluorescence, In Vitro, Recombinant, Produced, Strep-tag, Purification, Knockdown

Fig. 6. TMCPs catalyze the removal of posttranslational polyglutamylation. (A) Immunoblots of an in vitro deglutamylation assay measuring time-dependent activity of recombinant His-TMCP1 and His-TMCP2 toward MTs derived from mouse brain. (B) Graphical representation of His-TMCP1 and His-TMCP2 deglutamylase activities. Immunoblot signals (polyE antibody) were quantified for each time point (mean ± SD; n = 3 independent experiments). (C) Immunoblots of protein extracts from HEK293 cells coexpressing GFP-TTLL6, GFP-TTLL11, or GFP-TTLL13 in the presence of either active or enzymatically dead HA-TMCP1, HA-TMCP2, and HA-CCP1. (D) Immunoblots of protein extracts from SH-SY5Y cell knockdown for TMCP1 or TMCP2. Three different siRNAs were used for TMCP2, one siRNA for TMCP1, and a scramble siRNA as control. (E) Immunoblots of protein extracts from SH-SY5Y cells following knockdown of TMCP2 or CCP1, either alone or in combination. (F) Schematic overview of α- and β- tubulin modifications catalyzed by TMCP1 and TMCP2. The width of the arrows represents the cleavage efficiency.

Journal: Science advances

Article Title: A family of carboxypeptidases catalyzing α- and β-tubulin tail processing and deglutamylation.

doi: 10.1126/sciadv.adi7838

Figure Lengend Snippet: Fig. 6. TMCPs catalyze the removal of posttranslational polyglutamylation. (A) Immunoblots of an in vitro deglutamylation assay measuring time-dependent activity of recombinant His-TMCP1 and His-TMCP2 toward MTs derived from mouse brain. (B) Graphical representation of His-TMCP1 and His-TMCP2 deglutamylase activities. Immunoblot signals (polyE antibody) were quantified for each time point (mean ± SD; n = 3 independent experiments). (C) Immunoblots of protein extracts from HEK293 cells coexpressing GFP-TTLL6, GFP-TTLL11, or GFP-TTLL13 in the presence of either active or enzymatically dead HA-TMCP1, HA-TMCP2, and HA-CCP1. (D) Immunoblots of protein extracts from SH-SY5Y cell knockdown for TMCP1 or TMCP2. Three different siRNAs were used for TMCP2, one siRNA for TMCP1, and a scramble siRNA as control. (E) Immunoblots of protein extracts from SH-SY5Y cells following knockdown of TMCP2 or CCP1, either alone or in combination. (F) Schematic overview of α- and β- tubulin modifications catalyzed by TMCP1 and TMCP2. The width of the arrows represents the cleavage efficiency.

Article Snippet: Membranes were incubated with rabbit polyE (anti-polyglutamylation; 1:1000), mouse anti-GFP (1:5000; Torrey Pines Biolabs), rabbit anti-GST (1:2000), rabbit anti–detyrosinated α-tubulin [1:1000; (39)], rabbit anti–Δ2-tubulin (1:1000; gift of L. Lafanechère), mouse 6-11B-1 (anti–acetylated tubulin, 1:2000; Sigma-Aldrich), mouse 12G10 (anti–α-tubulin; 1:1000, DSHB), rat anti–tyrosinated tubulin [YL1/2; 1:1000; (55)], rabbit anti–βI-Δ3 (1:1000; this study), mouse anti-βI-tubulin (1:1000; Sigma-Aldrich, SAB4200732), rabbit anti–Sf9-Δ1-α-tubulin [1:1000; (23)], mouse GT335 [1:1000; (17)] rabbit anti–hemagglutinin (HA) (1:1000; Santa Cruz Biotechnology) or mouse anti-His (1:1000; ProteinTech) antibodies.

Techniques: Western Blot, In Vitro, Activity Assay, Recombinant, Derivative Assay, Knockdown, Control